← Feed

Posts

• View post

  Several cutescenes will play in sequence Type DADDY to confirm

• View post

  I've spent years trying to tell the cis guys I know that simpsons and futurama quotes are a very poor way to flirt to no results

• View post

  a lot of people think driving is PvP, but it's actually co-op, the player base is just extremely toxic

• View post

  dwarf jortress (it menaces with spikes of denim)

• View post

  if H3VR was so good how come they didn't make a H4VR

• View post

  Hear.. feel... twink...

• View post

  Dino Crisis would've been greatly improved and made slightly baffling if Regina was a shark

• View post

  Wrath and Glory time I am using the marine as a distraction as he struggles to operate a touchscreen vending machine to simply shoplift things instead

• View post

  fucked up that valve used AI and a time machine for Zoey's hands like that

• View post

  thinking about that one meme that goes "Spongebob me boy, I've had me genome sequenced! ACTGACTGACTGACTGACTGACTGACTGACTG"

• View post

  happy non-binary day, my pizza is 30 minutes late and counting

• View post

  seeing an article about amazon investing in renewables and reducing carbon use glancing out my window at one of their rusty ass diesel vans parked with the engine left running two doors down the street

• View post

  Kids these days have to play video games to get a "Weird Route", back in my day we didn't have GPS so any time you went out of town w-[dragged off stage via crook]

• View post

  skong awoo%

• View post

  me playing idler games out of context:

• View post

  you are a fucked up freak if you wake up and immediately get on a voice chat/phone call. why are you doing that to yourself

• View post

  important things about Tachi from metal cardbot: big kitty 60% legs keeps bending forward to get low enough to talk to human characters keeps doing crouched sprint starts exposed ball joint hips immense thighs

• View post

  the pooltoy furries don't want you to realise this, but even the dummy thick ones weigh like 5kg of plastic max and you can just duct tape them to the wall if they're being rowdy

• View post

  advantages of very tall fursona: people can't tell if you're looking at them or looking at their cleavage

• View post

  fursonae fursoña

• View post

  all of the americans logging on in the evening to see what words in what order pour out of me during a 2am caffeine crash

• View post

  Thinking about a pic I saw of a dog girl with big bappy paws wearing a shirt that said "I ♥️ femboys" thinking about her kneeling over one of my femboy characters, sitting on the back of their head and forcing them face down into thick, chunky padded toes, to be specific

• View post

  it's always interesting to come across something that "everyone knows" that someone doesn't

• View post

  realising that a bunch of old cyberpunk stuff is having their titles become more hackery sounding once again because no one knows how a file directory works any more

• View post

  @LB, I have found jars in the back of cupboards that had been further past their date than the duration of the confederacy

• View post

  you know, they're probably working on concepts for the 69th warframe at the moment

• View post

  an important thing to keep in mind about how over the top a lot of warframe build theorycrafting is, is that they're ally seething about their build being worse than rumblejack w/random bullshit mods + melee influence + going 40 minutes deep on survival as Koumei

• View post

  feeling like the Zap Branigan "Now here's a plan with some chest hair!" bit talking to someone else also GMing a Cyberpunk game because they're having their players fight 5 hired goons who have pistols and sporting equipment, and I'm putting mine up against several armoured vehicles

• View post

  from now on I'm answering "how long have you been in the fandom" questions with this

• View post

  there's really people out there spending 300+USD on a keyboard with no numpad